Phones
Phones

Phones

Undere
Undere

Undere

A Fucking Leaf
A Fucking Leaf

A Fucking Leaf

Dont Know
Dont Know

Dont Know

Teach Me
Teach Me

Teach Me

Effort
Effort

Effort

Fucked
Fucked

Fucked

Call Me On My Cell Phone
Call Me On My Cell Phone

Call Me On My Cell Phone

Passengers
Passengers

Passengers

But Hey
But Hey

But Hey

๐Ÿ”ฅ | Latest

Drugs, Jail, and Memes: ethiopienne Pro-tip: white privilege doesn't mean white people have perfect lives. It means that white people do not have to deal with institutionalized, systemic racism in addition to their everyday problems. It means institutionalized, systemic racism does not cause white people's everyday problems. If your first reaction is to be angry and comment why this is wrong, take a deep breath, slowly read the post again and wait for the words to sink in. Think about what this is saying and try to deeply consider what this means, especially coming from someone who is not white. No one is saying white people have perfect lives, don't have problems, or even that there's no way they can be bullied-discrimanated against because of how they look. The difference is that racism isn't just a feeling or thought, it's INSTITUTIONALIZED and SYSTEMATIC, which means that you have laws (Jim Crow, housing discrimination, voter ID laws-voter discrimination, redlining), history, powerful figures, etc etc etc against you, not just individuals being rude to you. Yes you can be white and poor, you can be white and be bullied, you can be white and have problems. It's just that these problems are NOT reinforced by or due to a historic, systematic, institutional oppression based solely on your race-ethnicity. In the US for example, the country was built by white men with laws for white men. Over time, many of these laws have changed: ex. everyone has the legal right to vote now, slavery is illegal, Jim Crow laws no longer exist. Unfortunately, these laws don't just end; they evolve. All people can vote, yet voter ID laws disproportionately prevent people of color in poor communities from voting. Slavery is illegal, yet black men disproportionately fill jail cells and are exploited for their labor while privatized prisons profit off their incarceration (see: war on drugs, or "13th" on Netflix). I can list examples like those two all day, but the point is that people of color continue to face institutionalized, systematic racism that has legal & political backing and an entire history causing and justifying it. White people do not have to deal with that, hence the term "white privilege." And, again, no one is saying white people don't have problems. That's not what "white privilege" means.
Drugs, Jail, and Memes: ethiopienne
 Pro-tip: white privilege
 doesn't mean white
 people have perfect lives.
 It means that white people do not have to
 deal with institutionalized, systemic racism in
 addition to their everyday problems. It means
 institutionalized, systemic racism does not
 cause white people's everyday problems.
If your first reaction is to be angry and comment why this is wrong, take a deep breath, slowly read the post again and wait for the words to sink in. Think about what this is saying and try to deeply consider what this means, especially coming from someone who is not white. No one is saying white people have perfect lives, don't have problems, or even that there's no way they can be bullied-discrimanated against because of how they look. The difference is that racism isn't just a feeling or thought, it's INSTITUTIONALIZED and SYSTEMATIC, which means that you have laws (Jim Crow, housing discrimination, voter ID laws-voter discrimination, redlining), history, powerful figures, etc etc etc against you, not just individuals being rude to you. Yes you can be white and poor, you can be white and be bullied, you can be white and have problems. It's just that these problems are NOT reinforced by or due to a historic, systematic, institutional oppression based solely on your race-ethnicity. In the US for example, the country was built by white men with laws for white men. Over time, many of these laws have changed: ex. everyone has the legal right to vote now, slavery is illegal, Jim Crow laws no longer exist. Unfortunately, these laws don't just end; they evolve. All people can vote, yet voter ID laws disproportionately prevent people of color in poor communities from voting. Slavery is illegal, yet black men disproportionately fill jail cells and are exploited for their labor while privatized prisons profit off their incarceration (see: war on drugs, or "13th" on Netflix). I can list examples like those two all day, but the point is that people of color continue to face institutionalized, systematic racism that has legal & political backing and an entire history causing and justifying it. White people do not have to deal with that, hence the term "white privilege." And, again, no one is saying white people don't have problems. That's not what "white privilege" means.

If your first reaction is to be angry and comment why this is wrong, take a deep breath, slowly read the post again and wait for the words t...

Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and Iโ€™m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells donโ€™t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But hereโ€™s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesnโ€™t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at โ€œsequencing DNAโ€ letter by letter, it is possible for you to learn how your DNA may differ from the personโ€™s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we havenโ€™t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, itโ€™s important to keep asking questions about it and staying curious about the letters in your cells!
Computers, Creepy, and Memes: TGGAACTTGAAGGAGGAACTAAAAGAAGCGGCTTCTAATAAATTCTATAGCTAAGGTCATCGAA
 GGTTACTTATTTTTTACTTTATTTAGGTTGCCTGATATTCACTTAGTCTGGCCTGCTAAACATG
 GACTTTTCCAGTATGCGTGGGTGTTACAACAGAAACCTTTATGTTTGCTTACAGGCTCCTCCTT
 TTTCTACACAGTGGTATGCATACTGTGACTACATGAAAACCAGACATCCAAGTGGAGACGGAAA
 AATTTCCCCAAACTTCCTTTAGTTCTAGTACACATTCTGACTTGTGTATGTGATAATACCCAAT
 GACATTTTCCCCTATGTACAAGGCAAACCTTTAATTTTATTCCTGGTGTTTCCAATTTCTTACT
 TAGTACTTTCCATTTAATCTTTCACTTCAACATTATTACCCCTCTCACTCATAACATTTCtttt
 tttttt tCTGCATAAGACTTTTCTAATTTGTCTGCTGTTTCTAATTCTTTTAAGTATCTTTGTT
 CCTCTATAGCTCCTCTGTCCTTCCTCAACTTCTTTTTCCTCTTTCATTTCCTTCTCAAAGCCTT
 TATAGATTCAATCCCTAGCAAATCATATATGGGTATATTTTCATTGTGCTATTCCTTTCATATG
 GAATATATTCTCTCAACAAGGTACTTACTAGTATTTCTTAAAACTTTCTTTTTGCAAATTATTT
 TCTTGAGCTAGCCTAAGCTCCAGAGGAAGGACATCTGTTACTACTATGGAATTGTAATTAGAAG
 TCTACTTTCCATTTATAGCTCTAAATTTTAAAAAATCCCTTGAGGTTAGTGACTTAACAGAAAA
 TAGAGAATTGTTATTGGGGATTTGGGACAGTATAAAGACAAGTACAAGCTGGAGATCTTTCATG
 GGTGGCACTGGGAGTTTGGGGCCTGTTTGCCCTCTGCTAAGATGATATGGACCCTACCTGAGAT
 TATTATGGCAGTCTAAAAGTACTGATTGTGCTGTCATCCATCTCCAGACTCACTGTTGGTACCT
 TATTTTATTCATGTTCAAAAATGGTATTATGATTCCTTCACTGACCCTGGCTTTTTTCTAAAGA
 AACACTCATGTGCTCAATAATTGCATTGACTAAAGTACAAAATAAAATAAAATTTGAATTAGTA
 AAGGTTTTAAAACACTTTAAAAAGGTCTAATCTCTGGTACTTTTTAAACATTCTAAAAATTAAA
 GGTTACATTAAAATGGTGCCTGTTGCTGAAAACATTACACTAGTCCTGATGTGTTATATGAAGT
 CCATAGAACTACAGGTTGGTTAGAATTAAATTATAGTTATTAAAGACAAGAATCTATTAGTATT
 GAATTCCAGATATAATGAGAATTTTGGCTTGCTGCCTTCCTGCCTTCAGCCTCCATAAATGGGG
 CATTTTAACCCCTAGCATTGTCCAACACCCAAAGATCAATCTGGTTCCTAATCAGAGGAAATAT
 TAATAGAAAGGTCCACTGGAGTCCTTAGCCTTGCAGTAAGTCATCCTTCTTCTATTCTGCCTCT
 TGCTTTTCCTTGTGACCAAATTCCTGCTTTGTACTGAAATTTAAGCAAATGGGTTCCTATTTTT
 CGTTTACCACCACTTGCTTTCCTTATCTTGTGCCTGACACCCTCTGGAACTGCCAGCTAACCTT
 TGGTGCCAGGTTACCATAGCATTTGGTCCTATTGACCCCTTAAGATGTCTTACGTTGCCTAAT
 GTTGGATCTTCTTGATGCCAACTACCTATCTGATTAGACTTCCTAACATTGCCTCTGCTATGAT
 TTGCACAGAATACCTGTAGTATTCAGAGGAGTATATCTAGTCTCCAGGATTCTGAATATCTCCT
 CTCTGGTCTATTCTACAGAGAGTCATTCTCTTTTGGCCCTTTGCTATAGTTAATCAATGTAATC
 ATTTACAAAGGAACTGAGTTCTTTTGCTTCATTCAGTAAAAAATAAGCAAATCAAGATGAAAAA
 GCTGGCCTTCAGGAGGCTCAACCTGCTTTATCATTGAGGTCTGTCTTCCCTGTATTTGAAGCTT
 TTTAAATAAACCATTCTAACCAGAAGAGAGAAGATGAAACAGTTAAAGCTCAAATCAAACAACT
Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of your DNA, and Iโ€™m REALLY exaggerating when I say a bit - what you see here is just 0.0000352% of all of the DNA inside one teeny cell. . While computers use 0s and 1s, the alphabet for DNA contains 4 letters: A T C G. In reality your cells donโ€™t actually read letters like we do, so each of those letters is really just a shortform for one of the 4 main molecules in DNA that cells understand. Each set of 3 letters codes for a different amino acid, so the hidden message in this text may end up being a bunch of amino acids that make up a protein. . But hereโ€™s the creepy-cool part: the text written here exists inside of you - either exactly as you see here, or with a few minor changes; maybe in your cells it starts with a G instead of a T, or ends with a C. And just like when you make a typo, sometimes a mistake in one letter doesnโ€™t really matter, and other times it can completely change the meaning of something (e.g. FACES -> FECES...). . Now that biotechnology has gotten pretty good at โ€œsequencing DNAโ€ letter by letter, it is possible for you to learn how your DNA may differ from the personโ€™s next to you. But because human DNA is about 3 billion letters long and 1 letter differences between people are pretty common, we havenโ€™t quite gotten around to figuring out which ones really matter and strongly predict disease, which differences only matter in combination with other ones, and which differences make no difference. . Legislation around what to do with your DNA data is even more behind than our scientific understanding of it. There are lots of interesting and tough bioethics debates surrounding DNA sequencing, including the privatization of sequences, incidental findings, and risk assessments! . Even as DNA sequencing becomes more and more routine, itโ€™s important to keep asking questions about it and staying curious about the letters in your cells!

Can you find the hidden message in this text? [guest post by @science.sam] . . Your cells can! This slew of letters is actually a bit of you...